View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0870_high_3 (Length: 364)
Name: NF0870_high_3
Description: NF0870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0870_high_3 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 62 - 344
Target Start/End: Complemental strand, 303898 - 303602
Alignment:
| Q |
62 |
atttggaattaaggattgttttttgaccatactttctccattcatgcccatcatctgttggtctttctgacacttcctcacacgtttctctagtttttct |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303898 |
atttggaattaaggattgttttttgaccatactttctccattcatgcccatcatctgttggtctttctgacacttcctcacacgtttctctagtttttct |
303799 |
T |
|
| Q |
162 |
gcaaattaacnnnnnnn--------------tgttcatattcctagctagcaaacaattaacatgattgtttttaatgattagtaccttcttttgtgaga |
247 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303798 |
gcaaattaaccatgatcaataaataaaaaaatgttcatattcctagctagcaaacaattaacatgattgtttttaatgattagtaccttcttttgtgaga |
303699 |
T |
|
| Q |
248 |
tcctctagcaccaggggtggaattagtcttgcaactatcttgagagtcctcttcagatttaatggttaaggaaaagtcttgttccctttgatgatgt |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
303698 |
tcctctagcaccaggggtggaattagtcttgcaactatcttgagagtcctcttcagatttaatggttaaggaaaagttttgttccctttgatgatgt |
303602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 88 - 164
Target Start/End: Complemental strand, 478778 - 478702
Alignment:
| Q |
88 |
ccatactttctccattcatgcccatcatctgttggtctttctgacacttcctcacacgtttctctagtttttctgca |
164 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||| |||||| ||| | ||| || |||| | ||||| ||||||| |
|
|
| T |
478778 |
ccatactgtctccattgatgcccatcatctgttggagtttctgtcaccttctcccatgtttgtgtagttcttctgca |
478702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 649 times since January 2019
Visitors: 6130