View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0870_high_5 (Length: 264)
Name: NF0870_high_5
Description: NF0870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0870_high_5 |
 |  |
|
| [»] chr8 (8 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 30 - 264
Target Start/End: Complemental strand, 13025257 - 13025023
Alignment:
| Q |
30 |
ttattatcccttagaatttcgaagtggtgattgggtttatttgccggacaaggatgatcctttttgggagagagatgtgcacgagctggatttgaatgac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13025257 |
ttattatcccttagaatttcgaagtggtgattgggtttattttccggacaaggatgatcctttttgggagagagatgtgcacgagctggatttgaatgac |
13025158 |
T |
 |
| Q |
130 |
agtttttgggaggnnnnnnngctcatattcaacttgtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatggggttg |
229 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13025157 |
agtttttgggaggaaaaaaagctcatattcaacttgtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatggggttg |
13025058 |
T |
 |
| Q |
230 |
atatgcctgcttcttgcccacattctctcgtgaac |
264 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13025057 |
atatgcctgcttcttgcccacgttctctcgtgaac |
13025023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 34 - 224
Target Start/End: Original strand, 18096280 - 18096470
Alignment:
| Q |
34 |
tatcccttagaatttcgaagtggtgattgggtttatttgccggacaaggatgatcctttttgggagagagatgtgcacgagctggatttgaatgacagtt |
133 |
Q |
| |
|
||||||||||||||| | ||| ||||||||||| ||| ||| |||||||||| ||||||||||||| ||||| ||| | || || |||||||| ||| |
|
|
| T |
18096280 |
tatcccttagaatttgaaggtgatgattgggtttgtttaccgaacaaggatgaccctttttgggagactgatgtacacaaccttgacatgaatgacggtt |
18096379 |
T |
 |
| Q |
134 |
tttgggaggnnnnnnngctcatattcaacttgtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatgg |
224 |
Q |
| |
|
||||||||| |||||| |||| |||||||| || || | |||||| ||||||||||| || |||||||||||||||| ||||| |
|
|
| T |
18096380 |
tttgggaggagaaggggctcattgtcaagttgtatgaaccattttgggagatgtatagcctcaagcgtgattcttggaggaaacttgatgg |
18096470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 167 - 224
Target Start/End: Complemental strand, 12712170 - 12712113
Alignment:
| Q |
167 |
atgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatgg |
224 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
12712170 |
atgaccctttctgggagatatatagcctcaaaagtaactcttggaggaaaatcgatgg |
12712113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 34 - 142
Target Start/End: Original strand, 18081854 - 18081962
Alignment:
| Q |
34 |
tatcccttagaatttcgaagtggtgattgggtttatttgccggacaaggatgatcctttttgggagagagatgtgcacgagctggatttgaatgacagtt |
133 |
Q |
| |
|
|||||||| |||||| | ||| ||||||||||| |||||||||||||||||| ||||||||||||| ||||| ||| | || || |||| |||| || |
|
|
| T |
18081854 |
tatccctttgaatttgaaggtgatgattgggtttgtttgccggacaaggatgaccctttttgggagattgatgtacaccaccttgacttgattgacgatt |
18081953 |
T |
 |
| Q |
134 |
tttgggagg |
142 |
Q |
| |
|
||||||||| |
|
|
| T |
18081954 |
tttgggagg |
18081962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 6117562 - 6117611
Alignment:
| Q |
167 |
atgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaa |
216 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
6117562 |
atgaccctttctgggagatatatagcctcaaaagtaactcttggaggaaa |
6117611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 224
Target Start/End: Complemental strand, 18139845 - 18139784
Alignment:
| Q |
163 |
ttgtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatgg |
224 |
Q |
| |
|
|||||||| ||||| | |||||| ||||| ||||||||| |||||||||||||||| ||||| |
|
|
| T |
18139845 |
ttgtatgaacctttttgggagatatatagtctcaaaagtgattcttggaggaaacttgatgg |
18139784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 222
Target Start/End: Original strand, 12724620 - 12724676
Alignment:
| Q |
166 |
tatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgat |
222 |
Q |
| |
|
||||| || |||| |||||| |||||||||| |||||| |||||||||||||||||| |
|
|
| T |
12724620 |
tatgaaccattcttggagatatatagcctcagaagtaactcttggaggaaactcgat |
12724676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 216
Target Start/End: Original strand, 12705461 - 12705508
Alignment:
| Q |
169 |
gaccctttctcggagatttatagcctcaaaagtaattcttggaggaaa |
216 |
Q |
| |
|
|||||||||| |||| | ||||||||||||||||| |||||||||||| |
|
|
| T |
12705461 |
gaccctttctgggagttatatagcctcaaaagtaactcttggaggaaa |
12705508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 165 - 237
Target Start/End: Original strand, 17747850 - 17747923
Alignment:
| Q |
165 |
gtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaac-tcgatggggttgatatgcct |
237 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| |||||| ||||||||||||| || ||||||||||||||||| |
|
|
| T |
17747850 |
gtatgaccctttctgtgagatatatagcctcataagtaactcttggaggaaacttcaatggggttgatatgcct |
17747923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 164 - 231
Target Start/End: Complemental strand, 22535565 - 22535498
Alignment:
| Q |
164 |
tgtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatggggttgat |
231 |
Q |
| |
|
||||||||||||| | |||||| || ||||| | |||||| |||||||||||||| ||||| |||||| |
|
|
| T |
22535565 |
tgtatgaccctttttgggagatatacagccttagaagtaactcttggaggaaacttgatggtgttgat |
22535498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University