View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0871_high_1 (Length: 421)
Name: NF0871_high_1
Description: NF0871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0871_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 7e-53; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 30 - 147
Target Start/End: Complemental strand, 6921286 - 6921170
Alignment:
| Q |
30 |
gtgtaaaggaagagggggaagatcaaacatagttttgaagatggagaatatgaaaatgaagatgcagccatcataaatttgaaagaaaaaggggaaaagc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6921286 |
gtgtaaaggaagagggggaagatcaaacatagttttgaagatggagaatatgaaaatgaagatgcagccatcataaatttgagagaaaaaggggaaaagc |
6921187 |
T |
|
| Q |
130 |
ttaggtgagtttgaaaga |
147 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6921186 |
-taggtgagtttgaaaga |
6921170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 186 - 282
Target Start/End: Complemental strand, 6921057 - 6920961
Alignment:
| Q |
186 |
ctacatattttaatgaatatttaatattttcttatggaagtgtcattcactcattcctttgtaatacctcttaagtttagatatcaaaatgagtact |
282 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | ||||||||| |||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6921057 |
ctacatattttaatgaatttttaatattttttcatggaagtgccatttactcattcctttgtaatacctcttaattttagatatcaaaatgagtact |
6920961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 361 - 408
Target Start/End: Complemental strand, 6920395 - 6920348
Alignment:
| Q |
361 |
gttaaaattgaaaaacacaaaacacaacatcattacacattcttcttc |
408 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6920395 |
gttaaaattgaaaaacacaaaacacaacaacattacacattcttcttc |
6920348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 351
Target Start/End: Complemental strand, 6920461 - 6920417
Alignment:
| Q |
307 |
attaaaaaagcatcatcattaatcaaacaaaaaatcttacacaca |
351 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6920461 |
attaaaaaaacatcatcattaatcaaacaaaaaatcttacacaca |
6920417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1250 times since January 2019
Visitors: 6138