View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0871_high_4 (Length: 211)
Name: NF0871_high_4
Description: NF0871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0871_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 56 - 190
Target Start/End: Complemental strand, 29933810 - 29933676
Alignment:
Q |
56 |
gtctctaaactttcaatttgtgcttgaattgttcaataaataaaatgtattttcagtgtgcattttgtaacctgaaagtttatcaatacacaatatctca |
155 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29933810 |
gtctctaaactttcaatttgtgcttgaattgttcaataaataaaatgtattttcagtgtgcattttgtaacctgaaagtttatcaatacacaatatctca |
29933711 |
T |
 |
Q |
156 |
cccaatcaaggaattgtttggtggtcttgatgatg |
190 |
Q |
|
|
||||||||||||||||||||||||||||| ||||| |
|
|
T |
29933710 |
cccaatcaaggaattgtttggtggtcttggtgatg |
29933676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 59 - 137
Target Start/End: Complemental strand, 29931231 - 29931153
Alignment:
Q |
59 |
tctaaactttcaatttgtgcttgaattgttcaataaataaaatgtattttcagtgtgcattttgtaacctgaaagttta |
137 |
Q |
|
|
||||||||||||||| ||| ||||| |||||||||||||||||| ||||| | |||||||| || |||||||||||| |
|
|
T |
29931231 |
tctaaactttcaattcgtgtcggaattcttcaataaataaaatgtactttcaatctgcattttatatcctgaaagttta |
29931153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1350 times since January 2019
Visitors: 6140