View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0871_low_10 (Length: 205)
Name: NF0871_low_10
Description: NF0871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0871_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 29934338 - 29934448
Alignment:
| Q |
1 |
caacatccttaagagttgcatcgtttggaagtctccaataatcaatagcaatagcaggagcaggtacattttcaactttaccactttcaattgcattcag |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29934338 |
caacatccttaagagttgcatcatttggaagtctccaataatcaatagcaatagcaggagcaggtacattttcaactttaccactttcaattgcattcag |
29934437 |
T |
 |
| Q |
101 |
atattgtgtgt |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
29934438 |
atattgtgtgt |
29934448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 2 - 109
Target Start/End: Original strand, 29931615 - 29931722
Alignment:
| Q |
2 |
aacatccttaagagttgcatcgtttggaagtctccaataatcaatagcaatagcaggagcaggtacattttcaactttaccactttcaattgcattcaga |
101 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
29931615 |
aacatccttaagagttgcatccttaggaagtctccaataatcaattgcaatagcaggagcaggtacattttcaactttaccactctcaattgcattcaaa |
29931714 |
T |
 |
| Q |
102 |
tattgtgt |
109 |
Q |
| |
|
| |||||| |
|
|
| T |
29931715 |
tgttgtgt |
29931722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University