View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0871_low_11 (Length: 205)

Name: NF0871_low_11
Description: NF0871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0871_low_11
NF0871_low_11
[»] chr5 (2 HSPs)
chr5 (4-128)||(29934235-29934359)
chr5 (4-80)||(29931559-29931635)


Alignment Details
Target: chr5 (Bit Score: 121; Significance: 3e-62; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 4 - 128
Target Start/End: Complemental strand, 29934359 - 29934235
Alignment:
4 gatgcaactcttaaggatgttgttactgttattcgtgctgatgaggctcatcatagggatgtcaatcactttgcttctgtaagtctgccatattttcatt 103  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29934359 gatgcaactcttaaggatgttgtcactgttattcgtgctgatgaggctcatcatagggatgtcaatcactttgcttctgtaagtctgccatattttcatt 29934260  T
104 ataattgtgataaatatgttttcat 128  Q
    |||||||||||||||||||||||||    
29934259 ataattgtgataaatatgttttcat 29934235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 4 - 80
Target Start/End: Complemental strand, 29931635 - 29931559
Alignment:
4 gatgcaactcttaaggatgttgttactgttattcgtgctgatgaggctcatcatagggatgtcaatcactttgcttc 80  Q
    ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||    
29931635 gatgcaactcttaaggatgttatcactgttattcgtgctgatgaggctcatcatagggatgtcaatcactttgcttc 29931559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2856 times since January 2019
Visitors: 6167