View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0871_low_11 (Length: 205)
Name: NF0871_low_11
Description: NF0871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0871_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 3e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 4 - 128
Target Start/End: Complemental strand, 29934359 - 29934235
Alignment:
| Q |
4 |
gatgcaactcttaaggatgttgttactgttattcgtgctgatgaggctcatcatagggatgtcaatcactttgcttctgtaagtctgccatattttcatt |
103 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29934359 |
gatgcaactcttaaggatgttgtcactgttattcgtgctgatgaggctcatcatagggatgtcaatcactttgcttctgtaagtctgccatattttcatt |
29934260 |
T |
 |
| Q |
104 |
ataattgtgataaatatgttttcat |
128 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
29934259 |
ataattgtgataaatatgttttcat |
29934235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 4 - 80
Target Start/End: Complemental strand, 29931635 - 29931559
Alignment:
| Q |
4 |
gatgcaactcttaaggatgttgttactgttattcgtgctgatgaggctcatcatagggatgtcaatcactttgcttc |
80 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29931635 |
gatgcaactcttaaggatgttatcactgttattcgtgctgatgaggctcatcatagggatgtcaatcactttgcttc |
29931559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University