View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0871_low_3 (Length: 399)

Name: NF0871_low_3
Description: NF0871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0871_low_3
NF0871_low_3
[»] chr7 (3 HSPs)
chr7 (279-370)||(46213086-46213177)
chr7 (17-85)||(46213370-46213438)
chr7 (111-188)||(46213272-46213344)


Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 279 - 370
Target Start/End: Complemental strand, 46213177 - 46213086
Alignment:
279 gctttgaaaaatgatatggttcttttctttccctcgctttcctttggttcaatgtcgtgttctatattggtgtttcacccgaacctgcttcc 370  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46213177 gctttgaaaaatgatatggttcttttctttccctcgctttcctttggttcaatgtcgtgttctatattggtgtttcacccgaacctgcttcc 46213086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 17 - 85
Target Start/End: Complemental strand, 46213438 - 46213370
Alignment:
17 cagagaatggtgaaacttgatcggttgacatgattaattaggacttaagaatgaacaaaagacccaaat 85  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
46213438 cagagaatggtgaaacttgatcggttgacatgattaattaggccttaagaatgaacaaaagacccaaat 46213370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 111 - 188
Target Start/End: Complemental strand, 46213344 - 46213272
Alignment:
111 acaaaatgggtggcatagaattcttagctagctataacaatggnnnnnnngatgtatagctgaatactgaaggaattt 188  Q
    ||||||||||||||||||||||||||    ||||||||||| |       ||||||||||||||||||||||||||||    
46213344 acaaaatgggtggcatagaattctta----gctataacaat-gaaaaaaagatgtatagctgaatactgaaggaattt 46213272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 785 times since January 2019
Visitors: 6131