View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0871_low_3 (Length: 399)
Name: NF0871_low_3
Description: NF0871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0871_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 279 - 370
Target Start/End: Complemental strand, 46213177 - 46213086
Alignment:
| Q |
279 |
gctttgaaaaatgatatggttcttttctttccctcgctttcctttggttcaatgtcgtgttctatattggtgtttcacccgaacctgcttcc |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46213177 |
gctttgaaaaatgatatggttcttttctttccctcgctttcctttggttcaatgtcgtgttctatattggtgtttcacccgaacctgcttcc |
46213086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 17 - 85
Target Start/End: Complemental strand, 46213438 - 46213370
Alignment:
| Q |
17 |
cagagaatggtgaaacttgatcggttgacatgattaattaggacttaagaatgaacaaaagacccaaat |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46213438 |
cagagaatggtgaaacttgatcggttgacatgattaattaggccttaagaatgaacaaaagacccaaat |
46213370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 111 - 188
Target Start/End: Complemental strand, 46213344 - 46213272
Alignment:
| Q |
111 |
acaaaatgggtggcatagaattcttagctagctataacaatggnnnnnnngatgtatagctgaatactgaaggaattt |
188 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
46213344 |
acaaaatgggtggcatagaattctta----gctataacaat-gaaaaaaagatgtatagctgaatactgaaggaattt |
46213272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University