View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0871_low_6 (Length: 282)

Name: NF0871_low_6
Description: NF0871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0871_low_6
NF0871_low_6
[»] chr4 (1 HSPs)
chr4 (53-231)||(16064848-16065026)


Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 53 - 231
Target Start/End: Original strand, 16064848 - 16065026
Alignment:
53 catcatctgcagggttgtcatttttcttacctagctcctcattagtcttaatttcttcttttatttcagcggtaacctctccatctttgagctcggttaa 152  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
16064848 catcatctgcagggttgtcatttttcttacctagctcctcattagtcttaatttcttcttttatttcagcggtaacctctccatctttgaactcggttaa 16064947  T
153 tttgcttttactttcatcacccctatatttggaattttgatctttttcttgattatcattcttagtcttactctgtgct 231  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
16064948 tttgcttttactttcatcacccccatatttggaattttgatctttttcttgattatcattcttagttttactctgtgct 16065026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2105 times since January 2019
Visitors: 6156