View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0871_low_7 (Length: 245)
Name: NF0871_low_7
Description: NF0871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0871_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 2106627 - 2106673
Alignment:
Q |
1 |
tgacatgatttctttgttaaaaacaactatggaactatccctttctt |
47 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2106627 |
tgacatgatttctttgttaaaaacaactatggaactatccctttctt |
2106673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University