View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0872_high_21 (Length: 223)
Name: NF0872_high_21
Description: NF0872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0872_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 69 - 192
Target Start/End: Complemental strand, 9394591 - 9394467
Alignment:
Q |
69 |
tgtcaaggtttctattctatttcatataatgttcataaatttctgtttttgatttcttgttgaaaatttgatg-tttagggtttatttctttgattgcat |
167 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
T |
9394591 |
tgtcaaggtttctattctatttcatataatgttcataaatttctgtttttgatttcttgttgaaaatttgatgttttagggtttatttctttgatttcat |
9394492 |
T |
 |
Q |
168 |
gctggcaactgtgtttttatgttat |
192 |
Q |
|
|
| ||||||||||||||||||||||| |
|
|
T |
9394491 |
gttggcaactgtgtttttatgttat |
9394467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 170
Target Start/End: Complemental strand, 9394002 - 9393947
Alignment:
Q |
114 |
tttttgatttcttgttgaaaatttgatgtttagggtttatttctttgattgcatgct |
170 |
Q |
|
|
||||||||||| ||||||||||||| | |||||| || |||||||||||| |||||| |
|
|
T |
9394002 |
tttttgatttcatgttgaaaatttggt-tttaggattcatttctttgatttcatgct |
9393947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 23 - 59
Target Start/End: Original strand, 38325836 - 38325872
Alignment:
Q |
23 |
gggtggaggctctcataagtggttttattcgcaacag |
59 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
38325836 |
gggtggaggctctcataagtggttttattcgcaacag |
38325872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 168
Target Start/End: Complemental strand, 1342067 - 1342018
Alignment:
Q |
120 |
atttcttgttgaaaatttgatgttt-agggtttatttctttgattgcatg |
168 |
Q |
|
|
||||| |||||||| |||| ||||| |||||||||||||||||||||||| |
|
|
T |
1342067 |
atttcatgttgaaattttggtgttttagggtttatttctttgattgcatg |
1342018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3390 times since January 2019
Visitors: 6174