View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0872_low_10 (Length: 392)
Name: NF0872_low_10
Description: NF0872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0872_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 139 - 381
Target Start/End: Original strand, 53699858 - 53700101
Alignment:
| Q |
139 |
tcctttgcagaagaaagctagctccttctgtggggtgtggcagtggtataccaaaattcccactatgatactaccaataataacaaacaattattctgct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53699858 |
tcctttgcagaagaaagctagctccttctgtgggttgtggcagtggtataccaaaattcccactatgatactaccaataataacaaacaattattctgct |
53699957 |
T |
|
| Q |
239 |
aattgttgaacatgattcagggagacacactatcgacatacattaaacttacaataccgtcatccttaccccaccac-tttgatgcttcaaagaatatca |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53699958 |
aattgttgaacatgattcagggagacacactatcgacatacattaaacttacaataccgtcatccttaccccaccacttttgatgcttcaaagaatatca |
53700057 |
T |
|
| Q |
338 |
tcaactccaaaaacaagaatatattttaacatcagaacattcat |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53700058 |
tcaactccaaaaacaagaatatattttaacatcagaacattcat |
53700101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1482 times since January 2019
Visitors: 6143