View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0872_low_14 (Length: 318)
Name: NF0872_low_14
Description: NF0872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0872_low_14 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 96 - 318
Target Start/End: Original strand, 4878318 - 4878540
Alignment:
| Q |
96 |
aatctaaacattattctcaaaagccaaaaactgcatatgcacaaatttgcaaaatgctagaatacatttatcatgtaccggtgtattcttttctatccac |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4878318 |
aatctaaacattattctcaaaagccaaaaactgcatatgcacaaatttgcaaaatgctagaatacatttatcatgtaccggtgtattcttttctatccac |
4878417 |
T |
|
| Q |
196 |
tcttatatactagttcaatattttgtccgctaccgtgatctcgattccatgtacctatttatgattggaattaagtgtccaataaacagcttatgagggt |
295 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4878418 |
tcttatatactagttcaatattttgttcgctaccgtgatctcgattccatgtacctatttatgattggaattaagtttccaataaacagcttatgagggt |
4878517 |
T |
|
| Q |
296 |
atatgcaacatatgtactattta |
318 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4878518 |
atatgcaacatatgtactattta |
4878540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 96 - 218
Target Start/End: Complemental strand, 12534166 - 12534044
Alignment:
| Q |
96 |
aatctaaacattattctcaaaagccaaaaactgcatatgcacaaatttgcaaaatgctagaatacatttatcatgtaccggtgtattcttttctatccac |
195 |
Q |
| |
|
||||| ||||| | ||| || ||| ||||| ||||||||||||||||||||||||| | |||||||||||| ||| ||| | |||||| || |||||| |
|
|
| T |
12534166 |
aatctgaacataactcttaacagcaaaaaagtgcatatgcacaaatttgcaaaatggtggaatacatttattatggaccagaatattctattttatccat |
12534067 |
T |
|
| Q |
196 |
tcttatatactagttcaatattt |
218 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
12534066 |
tcttatatactaattcaatattt |
12534044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2030 times since January 2019
Visitors: 6156