View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0872_low_19 (Length: 287)
Name: NF0872_low_19
Description: NF0872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0872_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 33 - 216
Target Start/End: Complemental strand, 54266185 - 54266002
Alignment:
Q |
33 |
ataatactcatgctttcttttttacaagtatatactatatattgctactaattgtaagtatattacataaatgagtaaaacaatcatttttgtttttaaa |
132 |
Q |
|
|
|||||| ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54266185 |
ataatattcatgctttcttttttacaagtatataatatatattgctactaatagtaagtatattacataaatgagtaaaacaatcatttttgtttttaaa |
54266086 |
T |
 |
Q |
133 |
atgtgaggtatagatgtgtttattgttaattttacatataacttgtgtcagtgtagtgtgttctgctctacatgctttggatta |
216 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
54266085 |
atgtgaggtatatatgtgtttattgttaattttacatataacttgcgtcagtgtagtgtgttctgctctacatgctttggatta |
54266002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University