View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0872_low_21 (Length: 275)
Name: NF0872_low_21
Description: NF0872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0872_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 54 - 269
Target Start/End: Original strand, 31420170 - 31420383
Alignment:
| Q |
54 |
atttctaagtaataaacttgttagaagnnnnnnnntacacatggctgaattcacagaaaattttcaaaatattattagaccttcttttccttttcttgat |
153 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
31420170 |
atttctaagtaataaacttgttagaa--aaaaaaatacacatggctgaattcacagaaaattttcaaaacattattagaccttctttgccttttcttgat |
31420267 |
T |
|
| Q |
154 |
tctgatcaaagcatggaactattgaatcaattcatggagaattcaaacatgaacatgatgcataatttgatgcctttttcttgtgacagcatcttggaac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31420268 |
tctgatcaaagcatggaactattgaatcaattcatggagaattcaaacatgaacatgatgcataatttgatgcctttttcttgtgacagcatcttggaac |
31420367 |
T |
|
| Q |
254 |
atcatcaacaacaaca |
269 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
31420368 |
atcatcaacaagaaca |
31420383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2708 times since January 2019
Visitors: 6167