View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0872_low_22 (Length: 269)
Name: NF0872_low_22
Description: NF0872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0872_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 30 - 247
Target Start/End: Original strand, 15117493 - 15117711
Alignment:
Q |
30 |
aaaacaaatataatttgatcttannnnnnnatcaaaccatcatcgaacatatcactgtctcaatcaaagacgaatagtactataatcttttgtttacaaa |
129 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||| | ||||||| |
|
|
T |
15117493 |
aaaacaaatataatttgatcttatttttttatcaaaccatcatcgatcatatcactgtctcaatcaaagacgagtagtactataagctttggcttacaaa |
15117592 |
T |
 |
Q |
130 |
gagcgacataatcgttgttaaagtttc--annnnnnnnnnnaaatagctgttcactataggccatatgagacacttccttgcgcatataccaccttattc |
227 |
Q |
|
|
||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
T |
15117593 |
gagcgacataatcgttgttaaagtttcaaatatttttttttaaatatctgttcactataggccatatgagacacttcctcgcgcatata-caccttattc |
15117691 |
T |
 |
Q |
228 |
atcatttagtatttagtcct |
247 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
15117692 |
atcatttagtatttagtcct |
15117711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2087 times since January 2019
Visitors: 6156