View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0872_low_23 (Length: 261)

Name: NF0872_low_23
Description: NF0872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0872_low_23
NF0872_low_23
[»] chr7 (1 HSPs)
chr7 (7-43)||(38325836-38325872)


Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 43
Target Start/End: Original strand, 38325836 - 38325872
Alignment:
7 gggtggaggctctcataagtggttttattcgcaacag 43  Q
    |||||||||||||||||||||||||||||||||||||    
38325836 gggtggaggctctcataagtggttttattcgcaacag 38325872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University