View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0872_low_24 (Length: 251)
Name: NF0872_low_24
Description: NF0872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0872_low_24 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 35740683 - 35740927
Alignment:
Q |
9 |
gaataatattacatggtgagctgatcaatgttgataatcttgtttgacctttttgttgatgatagtcataagggaactaacagttcaaattaattaattg |
108 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
35740683 |
gaataatattacatgttgagctgatcaatgttgataatcttgtttgacctttttgttgatgatagtcataagggaactaacagttcaaattaatcaattg |
35740782 |
T |
 |
Q |
109 |
catatttagatttgcggaggatttgtgaaaatcatagcaccatgattttctcaaacctatcgtgattacaagaatgc--atatatgtgtactcatattag |
206 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||| || ||||||||||| |
|
|
T |
35740783 |
catatttagatttgcggaggatttgtgaaaatcatagcaccatgattttgtcaaacctatcgtaattacaagaatgcatatatatctgcactcatattag |
35740882 |
T |
 |
Q |
207 |
ataatcatatcaccaaatagcgctagagataattggaaaagttca |
251 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
35740883 |
ataatcatatcaccaaatagcgctagagataattagaaaagttca |
35740927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University