View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0872_low_24 (Length: 251)

Name: NF0872_low_24
Description: NF0872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0872_low_24
NF0872_low_24
[»] chr7 (1 HSPs)
chr7 (9-251)||(35740683-35740927)


Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 35740683 - 35740927
Alignment:
9 gaataatattacatggtgagctgatcaatgttgataatcttgtttgacctttttgttgatgatagtcataagggaactaacagttcaaattaattaattg 108  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
35740683 gaataatattacatgttgagctgatcaatgttgataatcttgtttgacctttttgttgatgatagtcataagggaactaacagttcaaattaatcaattg 35740782  T
109 catatttagatttgcggaggatttgtgaaaatcatagcaccatgattttctcaaacctatcgtgattacaagaatgc--atatatgtgtactcatattag 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||  |||||| || |||||||||||    
35740783 catatttagatttgcggaggatttgtgaaaatcatagcaccatgattttgtcaaacctatcgtaattacaagaatgcatatatatctgcactcatattag 35740882  T
207 ataatcatatcaccaaatagcgctagagataattggaaaagttca 251  Q
    |||||||||||||||||||||||||||||||||| ||||||||||    
35740883 ataatcatatcaccaaatagcgctagagataattagaaaagttca 35740927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University