View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0872_low_25 (Length: 242)
Name: NF0872_low_25
Description: NF0872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0872_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 35746332 - 35746115
Alignment:
| Q |
16 |
tcatttttattccttggctctctcttttgagaaagttccattacaattctcatcatatcattaatttggtttttgcatcaacgttaggactagcccccta |
115 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35746332 |
tcattttaattccttggctctctcttttgagaaagttccattacaattctcatcatatcattaatttggtttttgcatcaacgttaggactagcccccta |
35746233 |
T |
 |
| Q |
116 |
aatgcatgcatattcatgcatgcatatgtctcaaatttttctattaccaacctaaaatttcatttctgagaggtttgaacattaattacattgctaattg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35746232 |
aatgcatgcatattcatgcatgcatatgtctcaaatttttctattaccaacctaaaatttcatttctgaaaggtttgaacattaattacattgctaattg |
35746133 |
T |
 |
| Q |
216 |
ttctttaattagaattat |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35746132 |
ttctttaattagaattat |
35746115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University