View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0872_low_28 (Length: 201)
Name: NF0872_low_28
Description: NF0872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0872_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 31839658 - 31839823
Alignment:
| Q |
1 |
tgaaaagaaagaaagcaaaatggtgaaatgaaatgtcgtcgtcaatgggaccatatccatgtttgtgttgctatacaaagagtacaggatgccatcaaac |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31839658 |
tgaaaagaaagaaagcaaaataatgaaatgaaatgtcgtcgtcaatggggccatatccatgtttgtgttgctatacaaagagtacaggatgccatcaaac |
31839757 |
T |
|
| Q |
101 |
tggagtgccaaaatcatgtaatgcttttaatgaaatgaaatctctgtttggcttctgtgagatatt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31839758 |
tggagtgccaaaatcatgtaatgcttttaatgaaatgaaatctctgtttggctcctgtgagatatt |
31839823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2195 times since January 2019
Visitors: 6159