View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0872_low_5 (Length: 455)
Name: NF0872_low_5
Description: NF0872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0872_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 107 - 363
Target Start/End: Complemental strand, 9394591 - 9394334
Alignment:
Q |
107 |
tgtcaaggtttctattctatttcatataatgttcataaatttctgtttttgatttcttgttgaaaatttgatgttt-agggtttatttctttgattgcat |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
T |
9394591 |
tgtcaaggtttctattctatttcatataatgttcataaatttctgtttttgatttcttgttgaaaatttgatgttttagggtttatttctttgatttcat |
9394492 |
T |
 |
Q |
206 |
gctggcaactgtgtttttatgttattttgtttgattttatgttgagaattttctgctttagggtttattcatatgatttcgtgttgaaaattgggtttta |
305 |
Q |
|
|
| ||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9394491 |
gttggcaactgtgtttttatgttattttgtttgattttatgttgaaaattttcttctttagggtttattcatatgatttcgtgttgaaaattgggtttta |
9394392 |
T |
 |
Q |
306 |
gtgtttatttcttttattgcatgttggaaattctgtttctattttaattatgttgaaa |
363 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
9394391 |
gtgtttatttcttttattgcatgttggaaattctgtttctattttatttatgttgaaa |
9394334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 395 - 444
Target Start/End: Complemental strand, 9394314 - 9394265
Alignment:
Q |
395 |
atggttcattggtttgaatttcatgttgaaaactgtgttttatggttcat |
444 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9394314 |
atggttcattggtttgaatttcatgttgaaaactgtgttttatggttcat |
9394265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 9394002 - 9393947
Alignment:
Q |
152 |
tttttgatttcttgttgaaaatttgatgtttagggtttatttctttgattgcatgct |
208 |
Q |
|
|
||||||||||| ||||||||||||| | |||||| || |||||||||||| |||||| |
|
|
T |
9394002 |
tttttgatttcatgttgaaaatttggt-tttaggattcatttctttgatttcatgct |
9393947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 158 - 274
Target Start/End: Complemental strand, 1342067 - 1341951
Alignment:
Q |
158 |
atttcttgttgaaaatttgatgttt-agggtttatttctttgattgcatgctggcaactgtgtttttatgttattttgtttgattttatgttgagaattt |
256 |
Q |
|
|
||||| |||||||| |||| ||||| |||||||||||||||||||||||| || || ||||| || ||||||||||||||||||||||||| | ||||| |
|
|
T |
1342067 |
atttcatgttgaaattttggtgttttagggtttatttctttgattgcatgttgaaaattgtgtatt-atgttattttgtttgattttatgttcaaaattt |
1341969 |
T |
 |
Q |
257 |
tctgctttagggtttatt |
274 |
Q |
|
|
| | ||||||||||||| |
|
|
T |
1341968 |
tgttttttagggtttatt |
1341951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 61 - 97
Target Start/End: Original strand, 38325836 - 38325872
Alignment:
Q |
61 |
gggtggaggctctcataagtggttttattcgcaacag |
97 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
38325836 |
gggtggaggctctcataagtggttttattcgcaacag |
38325872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 180 - 250
Target Start/End: Complemental strand, 31943977 - 31943907
Alignment:
Q |
180 |
tttagggtttatttctttgattgcatgctggcaactgtgtttttatgttattttgtttgattttatgttga |
250 |
Q |
|
|
|||||| ||||||||| ||||| |||| || || | || |||||||||||||||||||||||||||||| |
|
|
T |
31943977 |
tttaggatttatttctatgattacatgttgaaaattcggtgtttatgttattttgtttgattttatgttga |
31943907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University