View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0872_low_7 (Length: 431)
Name: NF0872_low_7
Description: NF0872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0872_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 35922766 - 35922561
Alignment:
Q |
1 |
caatgttataatgttttatgcacctgtgctatttagttctgttgggtttaaggatgatgctgcccttatgtcatctgtgataactggcgttgttaatgct |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35922766 |
caatgttataatgttttatgcacctgtgctatttagttctgttgggtttgaggatgatgctgcccttatgtcatctgtgataactggcgttgttaatgct |
35922667 |
T |
 |
Q |
101 |
tttggtaccattatctcaatttttggagttgatagattgggtaggagagccctttttcttgaaggtggtcttcaaatgctcatttgtcaggtaactatgt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
35922666 |
tttggtaccattatctcaatttttggagttgatagattgggtaggagagccctttttcttgaaggtggccttcaaatgctcatttgtcaggtaactatgt |
35922567 |
T |
 |
Q |
201 |
tgtgta |
206 |
Q |
|
|
|||||| |
|
|
T |
35922566 |
tgtgta |
35922561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 276 - 422
Target Start/End: Complemental strand, 35922485 - 35922339
Alignment:
Q |
276 |
ccaactatatttgttgatgtgcaaagattggagttgctgcatctattggagccaaatttggaattgatggaaaccctggtgagttaccaaagtggtatgc |
375 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35922485 |
ccaactatatttgttgatgtgcaaagattggagttgctgcatctattggagccaaatttggaattgatggaaaccctggtgagttaccaaagtggtatgc |
35922386 |
T |
 |
Q |
376 |
aattgttgtggtgctattcatttgcgcttatgtagcagcatattctt |
422 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
35922385 |
aattgttgtggtgctattcatttgcgcttatgtagcagcattttctt |
35922339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 36202292 - 36202486
Alignment:
Q |
1 |
caatgttataatgttttatgcacctgtgctatttagttctgttgggtttaaggatgatgctgcccttatgtcatctgtgataactggcgttgttaatgct |
100 |
Q |
|
|
||||||||| ||||||||||||||||||||||||| ||| ||||||||||||| |||||| | |||||||| |||| || || || |||||||||| | |
|
|
T |
36202292 |
caatgttatcatgttttatgcacctgtgctatttaattccattgggtttaaggacgatgcttcacttatgtcggctgtcatcaccggtgttgttaatgtt |
36202391 |
T |
 |
Q |
101 |
tttggtaccattatctcaatttttggagttgatagattgggtaggagagccctttttcttgaaggtggtcttcaaatgctcatttgtcaggtaac |
195 |
Q |
|
|
||| ||| | ||||||||| ||||||||||| | |||||||||||||||||| |||||||||||| |||||||||||| || |||||||| |
|
|
T |
36202392 |
gttgctacttgtgtctcaatttatggagttgataagtggggtaggagagcccttttccttgaaggtggtgctcaaatgctcatatgccaggtaac |
36202486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University