View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0873_high_1 (Length: 343)
Name: NF0873_high_1
Description: NF0873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0873_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 5e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 62 - 333
Target Start/End: Complemental strand, 28234794 - 28234522
Alignment:
Q |
62 |
atccatatagatattgacaatttatggtnnnnnnntaataattaattgatttgaattcagggacgcaaatgagtgcctttttgatttgttacatttgtcc |
161 |
Q |
|
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28234794 |
atccatatagatattaacaatttatggtaaaaa---aataattaattgatttgaattcagggacgcaaatgagtgcctttttgatttgttacatttgtcc |
28234698 |
T |
 |
Q |
162 |
cctttatgctttacataggtctgcactat---------tagccaatttgcaattattaaggcacacgaaannnnnnnnnaacagctaggacacatgaatt |
252 |
Q |
|
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
28234697 |
cctttatgctttacataggtctgcactatttaggaacatcgccaatttgcaattattaaggcacacgaattttttttttaacagctaggacacatgaatt |
28234598 |
T |
 |
Q |
253 |
tccatgataaaataaaattgaaaaatcactttctcaattgttccatcttgatcaatcgttagagaatccatttactctctg |
333 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
T |
28234597 |
tccatg-----ataaaattgaaaaatcactttctcaattgttccatcttcatcagtcgttagagaatccatttactctctg |
28234522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 506 times since January 2019
Visitors: 6130