View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0873_high_5 (Length: 291)
Name: NF0873_high_5
Description: NF0873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0873_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 33 - 259
Target Start/End: Original strand, 29135706 - 29135932
Alignment:
| Q |
33 |
gtgagagtggtggaaggaaggaaggtgaaacaagtgtgaatactattactgtatgtcagtggaatattacagtggaatttactacggtgagcttgctaat |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29135706 |
gtgagagtggtggaaggaaggaaggtgaaacaagtgtgaatactattactgtatgtcagtggaatattacagtggaatttactacggtgagcttgctaat |
29135805 |
T |
|
| Q |
133 |
cctttgcaatggccacagttgaggaaaaaacgacgcctatttgttgttccctccaaaacaagaacaaaactgctgcaagtgcaacctctcctaatgttcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29135806 |
cctttgcaatggccacagttgaggaaaaaacgacgcctatttgttgttccctccaaaacaagaacaaaactgctgcaagtgcaacctctcctaatgttcc |
29135905 |
T |
|
| Q |
233 |
tcagcaaaaacaacagctacctttcat |
259 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29135906 |
tcagcaaaaacaacagctacctttcat |
29135932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 81 - 170
Target Start/End: Original strand, 14294439 - 14294528
Alignment:
| Q |
81 |
ctgtatgtcagtggaatattacagtggaatttactacggtgagcttgctaatcctttgcaatggccacagttgaggaaaaaacgacgcct |
170 |
Q |
| |
|
|||||||||||||||||| |||||| | ||| ||||||||||||||||| |||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
14294439 |
ctgtatgtcagtggaatactacagtacagttttgtacggtgagcttgctaacccttcacaatggccacagctcaggaaaaaacgacgcct |
14294528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 570 times since January 2019
Visitors: 6130