View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0873_low_1 (Length: 437)
Name: NF0873_low_1
Description: NF0873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0873_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 4e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 255 - 403
Target Start/End: Complemental strand, 7499433 - 7499285
Alignment:
| Q |
255 |
gcacaagaattacactcgaaaatgatcgaatcatccggtttctccaaaagcttgtcaatggttgtattgcttacacctaaagaggtagcaactatctctc |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499433 |
gcacaagaattacactcgaaaatgatcgaatcatccggtttctccaaaagcttgtcaatggttgtattgcttacacctaaagaggtagcaactatctctc |
7499334 |
T |
|
| Q |
355 |
tgtctagaatttgcagcacagattctttaccagccaaaaactgatgatg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7499333 |
tgtctagaatttgcagcacagattctttaccagccaaaaactgaggatg |
7499285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 258 times since January 2019
Visitors: 6127