View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0873_low_10 (Length: 265)
Name: NF0873_low_10
Description: NF0873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0873_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 4e-84; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 2329832 - 2329671
Alignment:
| Q |
1 |
gaagccattggatgcttgtgatgattggtatatgtggtggaccaggggggagggttgcggtggttttcttggtggtggaaatggatgaaagggtggctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2329832 |
gaagccattggatgcttgtgatgattggtatatgtggtggaccaggggggagggttgcggtggttttcttggtggtggaaatggatgaaagggtggctct |
2329733 |
T |
 |
| Q |
101 |
gatgaggaagatgatgcagagagaaacaagtgcgatgaaccatatttccattacgtaaaagt |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2329732 |
gatgaggaagatgatgcagagagaaacaagtgcgatgaaccatgtttccattacgtaaaagt |
2329671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 3 - 160
Target Start/End: Complemental strand, 2350130 - 2349973
Alignment:
| Q |
3 |
agccattggatgcttgtgatgattggtatatgtggtggaccaggggggagggttgcggtggttttcttggtggtggaaatggatgaaagggtggctctga |
102 |
Q |
| |
|
|||||| |||| |||||||| || || ||||| |||||||| || |||||||||||||||||||| |||||||||| | ||| || | | ||||||||| |
|
|
| T |
2350130 |
agccataggatacttgtgataatggggatatgcggtggaccgggagggagggttgcggtggttttgttggtggtggtgagggaggagaagatggctctga |
2350031 |
T |
 |
| Q |
103 |
tgaggaagatgatgcagagagaaacaagtgcgatgaaccatatttccattacgtaaaa |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
2350030 |
tgaggaagatgatgcagagagaaacaagtgcaatgaaccatgtttccattacgtaaaa |
2349973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 94 - 163
Target Start/End: Complemental strand, 2326036 - 2325967
Alignment:
| Q |
94 |
tggctctgatgaggaagatgatgcagagagaaacaagtgcgatgaaccatatttccattacgtaaaagtt |
163 |
Q |
| |
|
||||| ||| ||||||||||||||| |||| || || ||||||||||| ||||||| ||||||||||| |
|
|
| T |
2326036 |
tggctttgacgaggaagatgatgcaaagagtaatgaggacgatgaaccatgtttccatcacgtaaaagtt |
2325967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University