View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0873_low_5 (Length: 316)
Name: NF0873_low_5
Description: NF0873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0873_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 29 - 303
Target Start/End: Original strand, 7331454 - 7331740
Alignment:
| Q |
29 |
agtacttggtagaaatctcttcacgtgaaacagcaagattctagatcaccaga--atagacccgctaataactcaagtcaatggatcatgcaatag---g |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||||||| ||| |||| | |
|
|
| T |
7331454 |
agtacttggtagaaatctcttcacgtgaaacagcaagattctagatcaccagagaatagatccgctaataacttaagtcaatggattatggtatagaaag |
7331553 |
T |
|
| Q |
124 |
nnnnnnnnnnncatgtgtatgaatcatctcaattttcttaaaattgttcacacaaatttaaaaatggataaactaaactaa---acaggaggcacatttt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||| |||||||||||||||| |
|
|
| T |
7331554 |
aaaaaaaaaaacatgtgtatgaatcatctcaattttcttaaaattgttcacacatatttaaaaattaataaactaaattaagtaacaggaggcacatttt |
7331653 |
T |
|
| Q |
221 |
----gataattttttatttgcacattaacagccaagagatgtttcagcaagacatgaaggatagtgacttaccaatctggactagaa |
303 |
Q |
| |
|
||||||||| |||||||||| |||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
7331654 |
acttgataattttatatttgcacaataacagccaaatgatgtttcagcaagagaggaaggatagtgacttaccaatctggactagaa |
7331740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 285 times since January 2019
Visitors: 6127