View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0873_low_7 (Length: 308)
Name: NF0873_low_7
Description: NF0873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0873_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 31247006 - 31247293
Alignment:
Q |
1 |
tcatcaagaagctccgcaaagcggtgagttatctatttatttatgtaattgttcagtcaatttgttaattcagggaattgattcattttagtggttagag |
100 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
31247006 |
tcatcaagaagctccgcaaggcggtgagttatctatttatttatgtaattgttcagtcaatttgttaattcagggaattaattcattttagtggttagag |
31247105 |
T |
 |
Q |
101 |
ttgtaaaaggaatttggaaaattgtaggatttgttnnnnnnngtggagtaatgttctaattgtgagcaatttggaaattgtttagggtttaggggatgga |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31247106 |
ttgtaaaaggaatttggaaaattgtaggatttgttaaaaaaagtagagtaatgttctaatggtgagcaatttggaaattgtttagggtttaggggatgga |
31247205 |
T |
 |
Q |
201 |
ttgatttgataatcaccattgatttgcaatagatatattttagtttgttcgcatttgcctttgtattttctgggtgctgtgatgatgt |
288 |
Q |
|
|
||||||||||||||||||||||| ||| ||| ||||||| ||||||||| ||||||||||| | |||||||||||||||||||||||| |
|
|
T |
31247206 |
ttgatttgataatcaccattgatctgcgataaatatattatagtttgtttgcatttgccttcgaattttctgggtgctgtgatgatgt |
31247293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 817 times since January 2019
Visitors: 6131