View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0874_high_22 (Length: 343)
Name: NF0874_high_22
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0874_high_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 7e-40; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 232 - 315
Target Start/End: Original strand, 26550177 - 26550260
Alignment:
| Q |
232 |
tggctacactaattttacctccaattcctccttctcctagagatgatgccatgcaactttaccgtgcttttaaaggtaccatat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26550177 |
tggctacactaattttacctccaattcctccttctcctagagatgatgccatgcaactttaccgtgcttttaaaggtaccatat |
26550260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 34 - 130
Target Start/End: Original strand, 26549976 - 26550074
Alignment:
| Q |
34 |
tataataattgtatgttgtccaaatggtacgtttagttg-cagatactcgttttctatctattggttgaacaattattgca-ttcatacatcattgtca |
130 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||||||| |||||| || ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26549976 |
tataataattgcatgttgtccaaatggtacgtttagttgacagatactcattttctttccattggttgaacaattattgcatttcatacatcattgtca |
26550074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 232 - 310
Target Start/End: Original strand, 26562502 - 26562580
Alignment:
| Q |
232 |
tggctacactaattttacctccaattcctccttctcctagagatgatgccatgcaactttaccgtgcttttaaaggtac |
310 |
Q |
| |
|
|||||||||| || ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26562502 |
tggctacacttgttgtacctccaattccaccttctcctagagatgatgccatgcaactttaccgtgctttcaaaggtac |
26562580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 232 - 310
Target Start/End: Original strand, 26557233 - 26557311
Alignment:
| Q |
232 |
tggctacactaattttacctccaattcctccttctcctagagatgatgccatgcaactttaccgtgcttttaaaggtac |
310 |
Q |
| |
|
|||||||||| || |||||||| ||||||||||||| ||| ||||| |||||||||||||||||||| |||||||| |
|
|
| T |
26557233 |
tggctacacttgttgtacctccagctcctccttctcctctagacgatgcgatgcaactttaccgtgctttcaaaggtac |
26557311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 247 - 311
Target Start/End: Complemental strand, 50937526 - 50937462
Alignment:
| Q |
247 |
tacctccaattcctccttctcctagagatgatgccatgcaactttaccgtgcttttaaaggtacc |
311 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
50937526 |
tacctccatttcccccttctcctagagatgatgcgatgcaactttaccgtgctttcaaaggtacc |
50937462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 255 - 308
Target Start/End: Complemental strand, 45508309 - 45508256
Alignment:
| Q |
255 |
attcctccttctcctagagatgatgccatgcaactttaccgtgcttttaaaggt |
308 |
Q |
| |
|
||||||||||| || ||||| ||||| ||||||||| |||||||||| |||||| |
|
|
| T |
45508309 |
attcctccttcccccagagacgatgctatgcaacttcaccgtgctttcaaaggt |
45508256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University