View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0874_high_39 (Length: 249)
Name: NF0874_high_39
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0874_high_39 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 28 - 249
Target Start/End: Original strand, 50041817 - 50042039
Alignment:
Q |
28 |
ttaatcgcttctatttgttaaacctaatctctaattcgaatcatactcgatgcgatcttccattcgaaccaaacgatacacgatttgattcattattcaa |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50041817 |
ttaatcgcttctatttgttaaacctaatctctaattcgaatcatactcgatgcgatcttccattcgaaccaaacgatacacgatttgattcattattcaa |
50041916 |
T |
 |
Q |
128 |
tttcatctttctttgcttaa-tcgtgcagagatgtcaaacgaagctcaatctataatggagaacatgcttaagatgatcgcgttagttacttaatcataa |
226 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50041917 |
tttcatctttctttgcttaattcgtgcagagatgtcaaacgaagctcaatctataatggagaacatgcttaagatgatcgcgttagttacttaatcataa |
50042016 |
T |
 |
Q |
227 |
ttatttcttcattttttacatca |
249 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
50042017 |
ttatttcttcattttttacatca |
50042039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University