View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0874_high_40 (Length: 236)

Name: NF0874_high_40
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0874_high_40
NF0874_high_40
[»] chr3 (1 HSPs)
chr3 (14-204)||(13399068-13399253)


Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 14 - 204
Target Start/End: Complemental strand, 13399253 - 13399068
Alignment:
14 cacagatctgataatgtaactcgataatacttttaggatcaacgatattttcccacctgaagtaaacaaattaaaacggctcagattaatgaaagacacg 113  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |    
13399253 cacagatctgataatgtaactcgatagtacttttaggatcaacgatattttcccacctgaagtaaacaaattaaaacggcttagattaatgaaagagatg 13399154  T
114 tgattccaaacctggtttcttctgcaaaattgatgcaataactaggttttataaaacaaattaaaattgcagacaacacaagataaattgt 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||    
13399153 tgattccaaacctggtttcttctgcaaaattgatgcaataactaggttttataaaac-----aaaattgcagacaacacaagataaattgt 13399068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3717 times since January 2019
Visitors: 6175