View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0874_high_40 (Length: 236)
Name: NF0874_high_40
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0874_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 14 - 204
Target Start/End: Complemental strand, 13399253 - 13399068
Alignment:
Q |
14 |
cacagatctgataatgtaactcgataatacttttaggatcaacgatattttcccacctgaagtaaacaaattaaaacggctcagattaatgaaagacacg |
113 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | | |
|
|
T |
13399253 |
cacagatctgataatgtaactcgatagtacttttaggatcaacgatattttcccacctgaagtaaacaaattaaaacggcttagattaatgaaagagatg |
13399154 |
T |
 |
Q |
114 |
tgattccaaacctggtttcttctgcaaaattgatgcaataactaggttttataaaacaaattaaaattgcagacaacacaagataaattgt |
204 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
13399153 |
tgattccaaacctggtttcttctgcaaaattgatgcaataactaggttttataaaac-----aaaattgcagacaacacaagataaattgt |
13399068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University