View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0874_high_43 (Length: 208)
Name: NF0874_high_43
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0874_high_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 43193426 - 43193551
Alignment:
| Q |
1 |
caaatggcgaagcagctaccttgtgacgccgatggtgtttgcatggcgtgtaaaacgaagcctctagaaactgaaacccttcattgtcgaacatgtgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43193426 |
caaatggcgaagcagctaccttgtgacgccgatggtgtttgcatggcgtgtaaaacgaagcctctagaaactgaaacccttcattgtcgaacatgtgcaa |
43193525 |
T |
|
| Q |
101 |
ctccatggcatgttccttgtttacct |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43193526 |
ctccatggcatgttccttgtttacct |
43193551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3625 times since January 2019
Visitors: 6174