View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0874_low_30 (Length: 361)
Name: NF0874_low_30
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0874_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 21 - 334
Target Start/End: Original strand, 31629344 - 31629649
Alignment:
Q |
21 |
acatcatcactactaatattcttcaataaaaattgtatcatttcaagatattacaaattgaagttactttagtgaaattacatatgtttgatttctgtct |
120 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31629344 |
acatcatcactactaattttcttcaataaaaattgtatcatttcaagatattacaaattgaagttactttagtgaaattacatatgtttgatttctgtct |
31629443 |
T |
 |
Q |
121 |
ttgctttcaagcctcactttgactaggagtcatccaaagtaacttctatattggattgacaattttacaccgactttacttcaaacttcccttgagaatg |
220 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31629444 |
ttgctttcaagcctcactttgac--------atccaaagtaacttctatattggattgacaattttacaccgactttacttcaaacttcccttgagaatg |
31629535 |
T |
 |
Q |
221 |
agattgtctaaatataaatcacttatttcaaaatcgattataaccaaatgaattatgttccaaatcacaaaatatttacccaaacacacctaatcaaacc |
320 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31629536 |
agattgtctaaatataaatcacttatttcaaaatcgattataaccaaatgaattatgtcccaaatcacaaaatatttacccaaacacacctaatcaaacc |
31629635 |
T |
 |
Q |
321 |
aaactagctatttg |
334 |
Q |
|
|
|||||||||||||| |
|
|
T |
31629636 |
aaactagctatttg |
31629649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3565 times since January 2019
Visitors: 6174