View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0874_low_34 (Length: 339)
Name: NF0874_low_34
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0874_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 241
Target Start/End: Original strand, 33966493 - 33966724
Alignment:
Q |
10 |
aataatatgtcttccatcgaagcttatctactactcaagtccaatcaattgattaccttaacatacatattttatcacaatttttcgcaatatcaagaat |
109 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33966493 |
aataatatgtcttccatccaagcttatctactactcgagtccaatcaattgattaccttaacatacatattttatcacaatttttcgcaatatcaagaat |
33966592 |
T |
 |
Q |
110 |
tccgacgtgaccgcaaattaaaaactttggacacaatcacaccacaaacaaaggaaaatgagataaagtatagtactactcacgtgtaaactcctgcatg |
209 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33966593 |
tccgacgtgaccgcaaattaaaaactttggacacaatgacaccacaaacaaaggaaaatgagataaagtatagtactactcacgtgtaaactcctgcatg |
33966692 |
T |
 |
Q |
210 |
aaccttgatgacaactctaacaagattgatgg |
241 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
33966693 |
aaccttgatgacaactctaacaagattgatgg |
33966724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 227
Target Start/End: Complemental strand, 43076909 - 43076868
Alignment:
Q |
186 |
tactcacgtgtaaactcctgcatgaaccttgatgacaactct |
227 |
Q |
|
|
|||| |||||||||| |||||||||||||| ||||||||||| |
|
|
T |
43076909 |
tacttacgtgtaaacccctgcatgaaccttaatgacaactct |
43076868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2673 times since January 2019
Visitors: 6164