View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0874_low_43 (Length: 290)
Name: NF0874_low_43
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0874_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 12 - 261
Target Start/End: Complemental strand, 32457409 - 32457160
Alignment:
| Q |
12 |
ataggggccgagcagcagcatatgtgaagaacttccttctaaagaggttccgactattctcaaatatcggggtaagagctggggcatgacttataatggg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32457409 |
ataggggccgagcagcagcatatgtgaagaacttccttctaaagaggttccgactattctcaaatatcggggtaagagttggggcatgacttataatggg |
32457310 |
T |
 |
| Q |
112 |
cagaacaaaaccaaacagtttgatagtgttagctgggaaaaatttgctgaagattattatttgaagcttggagacgcttgtgtttttgagctcatgaaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32457309 |
cagaacaaaaccaaacagtttgatagtgttagctgggaaaaatttgctgaagataattatttgaagcttggagacgcttgtgtttttgagctcatgaaaa |
32457210 |
T |
 |
| Q |
212 |
acagcgaagaggaaatcgtcttcaaagttcaaattcttagaggtgaagaa |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32457209 |
acagcgaagaggaaatcgtcttcaaagttcaaattcttagaggtgaagaa |
32457160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University