View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0874_low_47 (Length: 263)
Name: NF0874_low_47
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0874_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 40588808 - 40589024
Alignment:
Q |
1 |
agagctttgcattgaagagggtgagagtgacattgaagacaagcttttcttaaaagtcctgttgaagttgcaagcatagcactagcaacatgaagaggtg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40588808 |
agagctttgcattgaagagggtgagagtgacattgaagacaagcttttcttaaaattcctgttgaagttgcaagcatagcactagcaacatgaagaggtg |
40588907 |
T |
 |
Q |
101 |
tcacttgtgcatgacctcttcttgttgctagattcactgcttgtttaacaacagttgcagcttcttgtgtaagtgcttgaagttgtatactgcaaattcc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
T |
40588908 |
tcacttgtgcatgacctcttcttgttgctagattcactgcttgtttaacaacagttgcagcttcttgtgtaagtgcttgaagctgtatactacaaattcc |
40589007 |
T |
 |
Q |
201 |
tcctctcatgatcttcg |
217 |
Q |
|
|
||||||||||||||||| |
|
|
T |
40589008 |
tcctctcatgatcttcg |
40589024 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 7 - 53
Target Start/End: Complemental strand, 25118066 - 25118020
Alignment:
Q |
7 |
ttgcattgaagagggtgagagtgacattgaagacaagcttttcttaa |
53 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
T |
25118066 |
ttgcattgaagagggtgagagtgagattgaagacaagctgttcttaa |
25118020 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University