View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0874_low_49 (Length: 260)
Name: NF0874_low_49
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0874_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 39 - 238
Target Start/End: Complemental strand, 42699726 - 42699527
Alignment:
Q |
39 |
acgaaggcacgaaaaaactccagccaatgaaaaacaaacaacttagtgactttaaagttttggagggtcgtactcatcaatcttccatatctataaattg |
138 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
42699726 |
acgaaggcacgaaaaaactccagccaatgaaaaacaaacaagttagtgactttaaagttttggagggtcgtactcatcaatcttccatatctataaaatg |
42699627 |
T |
 |
Q |
139 |
agtctaattatggaaagcttcttcaaataatcataactatgtttgaatgtttcaatatgtcaatgtaagtgtgtctcagaacaccaatataggctagtat |
238 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42699626 |
agtctaattatggaaagcttcttcaaataatcataactatgtttgaatgtttcaataggtcaatgtaagtgtgtctcagaacaccaatataggctagtat |
42699527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3408 times since January 2019
Visitors: 6174