View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0874_low_51 (Length: 251)
Name: NF0874_low_51
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0874_low_51 |
 |  |
|
[»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 46108974 - 46108739
Alignment:
Q |
16 |
atggaatggagatgatgttnnnnnnncgagcaccaaaaacataaactgcacaaacaggttcttaaagcacgagaaccaacaatgctcaccttaattatgt |
115 |
Q |
|
|
||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46108974 |
atggaatggagataatgttaaaaaaacgagcaccaaaaacataaactgcacaaacatgttcttaaagcacgagaaccaacaatgctcaccttaattatgt |
46108875 |
T |
 |
Q |
116 |
tgatatcattgaagctacggatagcaaagtatcgtcgcaaattccaaatcttagtcggatttctcacaacattgtcggcgaacttgtgattaggaatatg |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
46108874 |
tgatatcattgaagctacggatagcaaagtatcgtcgcaaattccaaatcttagtcggatttctcacaacattgtccgcgaacttgtgattaggaatatg |
46108775 |
T |
 |
Q |
216 |
aactgcctcacgatcagcgaatttgtgattagggat |
251 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
46108774 |
aactgcctcacgatcagcgaatttgtgattagggat |
46108739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 168 - 231
Target Start/End: Complemental strand, 46099001 - 46098938
Alignment:
Q |
168 |
agtcggatttctcacaacattgtcggcgaacttgtgattaggaatatgaactgcctcacgatca |
231 |
Q |
|
|
|||| ||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||| |
|
|
T |
46099001 |
agtcagatttctcacaacattgacagtgaacttgtgattaggaatatgaactgcctcacgatca |
46098938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2680 times since January 2019
Visitors: 6165