View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0874_low_53 (Length: 251)
Name: NF0874_low_53
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0874_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 7424122 - 7424349
Alignment:
| Q |
1 |
tttattaacaagctgaattccacca----attgattataccgtccaattctatgcttaagtagattttaattcaaccattaacaatagtac--taatact |
94 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7424122 |
tttattaaccagctgaattccaccacttaattgattataccgtccaattctatgcttaagtagattttaattcaaccattaacaatagtacactaatact |
7424221 |
T |
 |
| Q |
95 |
gtttcctattatgattccaaaagtatttgttattagtatttgttattaggggcccgataaaacaaatcatctctctttcaccaactataagactactata |
194 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7424222 |
gtttcctattatgattccaaaagta-------------tttgttattaggggcccgataaaacaaatcatctctctttcaccaactataagactactata |
7424308 |
T |
 |
| Q |
195 |
ttatcccatccaatattaaaaaactactacaccatgcatta |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7424309 |
ttatcccatccaatattaaaaaactactacaccatgcatta |
7424349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University