View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0874_low_6 (Length: 552)
Name: NF0874_low_6
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0874_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 414; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 414; E-Value: 0
Query Start/End: Original strand, 9 - 458
Target Start/End: Original strand, 3109538 - 3109988
Alignment:
| Q |
9 |
gaagaatattccaaggaattggatgttgctgtcagagcagtgcaaatggcttgttcactttgtcagagagtgcaggagagtttgatttccaaaaccaatc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3109538 |
gaagaatattccaaggaattggatgttgctgtcagagcagtgcaaatggcttgttcactttgtcagagagtgcaggagagtttgatttccaaaaccaatc |
3109637 |
T |
|
| Q |
109 |
atcaggttcagtctaaggatgataattctcctgttactgttgctggttagtcttttaactcaactgggtcatttcatatagttctttatttttgctctga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3109638 |
atcaggttcagtctaaggatgataattctcctgttactgttgctggttagtcttttaactcaactgggtcatttcatatagttctttatttttgctctga |
3109737 |
T |
|
| Q |
209 |
tttcattgtttgcacatgggtttatgtttgtctatgnnnnnnncacatcttttctgattttgtcacatgggtttatttggatgtctgcattggaattgga |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3109738 |
tttcattgtttgcacatgggtttatgtttgtctatgaaaaaaacacatcttttctgattttgtcacatgggtttatttggatgtctgcattggaattgga |
3109837 |
T |
|
| Q |
309 |
tattatactatcttgcatcaaattctagaaatgttagtatattagttgttaccatag-tttcggtattcgaacgaatatttattccggtgtcccttagct |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
3109838 |
tattatactatcttgcatcaaattctagaaatgttagtatattagttgttaccatagttttcggtattcgaacgaatactttttccggtgtcccttagct |
3109937 |
T |
|
| Q |
408 |
taccaaccgagctgcttacttgggacgcagatttttgtagtagaggtttat |
458 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3109938 |
taccaaccgagctgcttacttgggacgcagatttttgtagtagaggtttat |
3109988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 9 - 100
Target Start/End: Complemental strand, 35895280 - 35895189
Alignment:
| Q |
9 |
gaagaatattccaaggaattggatgttgctgtcagagcagtgcaaatggcttgttcactttgtcagagagtgcaggagagtttgatttccaa |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| || ||||| || || || ||||| | |||||| || | ||||||||||| |
|
|
| T |
35895280 |
gaagaatattccaaagaattggatgttgctgtcagagcagtccagatggcatgctctctatgtcaaaaagtgcaagaaaccttgatttccaa |
35895189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2025 times since January 2019
Visitors: 6156