View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0874_low_61 (Length: 224)
Name: NF0874_low_61
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0874_low_61 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 38299399 - 38299577
Alignment:
| Q |
1 |
ccagattctcatttacatcaccctaaaccattataacaagaaagcgttatgttctacatctgtggcctcacctgaagttagtttccatattaggctctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38299399 |
ccagattctcatttacatcaccctaaaccattataacaagaaagcgttatgttctacatctgtggcctcacctgaagttagtttccatattaggctctct |
38299498 |
T |
 |
| Q |
101 |
acaaaattggcataattggaagtttttgttatttaggacaacggaatgttctaaatttgcatggctttctctcagtggt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38299499 |
acaaaattggcataattggaagtttttgttatttaggacaacggaatgttctaaatttgcatggctttctctcagtggt |
38299577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University