View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_high_18 (Length: 458)
Name: NF0875_high_18
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 409; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 409; E-Value: 0
Query Start/End: Original strand, 30 - 446
Target Start/End: Original strand, 41736112 - 41736528
Alignment:
| Q |
30 |
ggaacactgtaatgtcttgtgcagttcaggagtttatgtatgatgatgtgtttcgattgttttgtgatatgctggtgattgatggtttgaaagttgatta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41736112 |
ggaacactgtaatgtcttgtgcagttcaggagtttatgtatgatgatgtgtttcgattgttttgtgatatgctggtgattgatggtttgaaagttgatta |
41736211 |
T |
|
| Q |
130 |
ttttactctgtcaacgtttttgacggcgtgtgctgcaagtgggttgttgatggaagggaagcaagtgcatgcgcatgctgttaaggttggtttggaggat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41736212 |
ttttactctgtcaacgtttttgacggcgtgtgctgcaagtgggttgttgatggaagggaagcaagtgcatgcgcatgctgttaaggttggtttggaggat |
41736311 |
T |
|
| Q |
230 |
gaattgaatgttgggaatgcccttattggattttatacaaattttggagatattgatgacgtggtttgtttgtttgagaggatgagtgtgagagatgtta |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41736312 |
gaattgaatgttgggaatgcccttattggattttatacaaatttcggagatattgatgacgtggtttgtttgtttgagaggatgagtgtgagagatgtta |
41736411 |
T |
|
| Q |
330 |
taacttggacagagatggtgagggtgtatatggaatttggttttgttgatttgggtttgaagatatttgatgagatgccagagaaaaattgtgtgactta |
429 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41736412 |
taacttggacagagatggtgagggtgtatatggaatttggttttgttgatttgggtttgaagatatttgatgagatgccggagaaaaattgtgtgactta |
41736511 |
T |
|
| Q |
430 |
taatgttcttttgtctg |
446 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41736512 |
taatgttcttttgtctg |
41736528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3557 times since January 2019
Visitors: 6174