View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_high_21 (Length: 423)
Name: NF0875_high_21
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0875_high_21 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-159; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 9 - 423
Target Start/End: Original strand, 2856440 - 2856847
Alignment:
Q |
9 |
agcagagaacaaagtggtttcagctttagagatgaatcttttaggatggaagtgacgtagacgattattagcttgggaggaggtgcaggttcatgagtgt |
108 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
T |
2856440 |
agcagagaaca--gtggtttcagctttagagatgaatcttttaggatggaagtgacgtagacgattattagcttgggaggaggagcaggttcaggagtgt |
2856537 |
T |
 |
Q |
109 |
agtgctttgttgcttaacattgtgttgcagatcgacgagttagacaggtggtaatggaaattacactcatcccaacactatacaacgagctcagcttatc |
208 |
Q |
|
|
||||||||||||||||| |||||||||||| || |||| ||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |||||| |
|
|
T |
2856538 |
agtgctttgttgcttaaaattgtgttgcaggtcaacgatttagacaggtggtaatggaaattacactcatcccaacgctatacaaccagctcaacttatc |
2856637 |
T |
 |
Q |
209 |
atta--tgacatctttggaagctgatacaactcaataatttttagacatcatttgacataaagctgctccttcaaaaaccagtatctttgctcaccgtct |
306 |
Q |
|
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||| ||| || | ||||||||||||| ||||||||||||||| |
|
|
T |
2856638 |
attatttgacatctttgaaagctgatacaactcaataatttttagacatcatttaacacaagacggctccttcaaaaa-------ctttgctcaccgtct |
2856730 |
T |
 |
Q |
307 |
tcttcagaatcgaattgcaacaatagataacctattgtgcgaggtttacgtaaaaaatcaacaacttttatataggtggatgtggatctcatgaggatag |
406 |
Q |
|
|
|||||| ||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
T |
2856731 |
tcttcataatcgaattccaacaatatataatctattgtgcgaggtttacgtaaaaaatcaacaacttttatatgggtggttgtggatctcatgaggatag |
2856830 |
T |
 |
Q |
407 |
caatcatttgtttttgc |
423 |
Q |
|
|
||||||||||||||||| |
|
|
T |
2856831 |
caatcatttgtttttgc |
2856847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 73 - 135
Target Start/End: Complemental strand, 20689160 - 20689098
Alignment:
Q |
73 |
ttattagcttgggaggaggtgcaggttcatgagtgtagtgctttgttgcttaacattgtgttg |
135 |
Q |
|
|
|||||||| |||||||||| ||| || | |||||||||||||||||||| ||| ||||||||| |
|
|
T |
20689160 |
ttattagcatgggaggaggagcatgtacttgagtgtagtgctttgttgcataatattgtgttg |
20689098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 82 - 138
Target Start/End: Original strand, 36564128 - 36564184
Alignment:
Q |
82 |
tgggaggaggtgcaggttcatgagtgtagtgctttgttgcttaacattgtgttgcag |
138 |
Q |
|
|
|||||||||| ||||||||| ||||||||||| ||||| | ||| |||||| ||||| |
|
|
T |
36564128 |
tgggaggaggagcaggttcaggagtgtagtgcattgttacataatattgtgatgcag |
36564184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3590 times since January 2019
Visitors: 6174