View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_high_34 (Length: 321)
Name: NF0875_high_34
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_high_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 188 - 292
Target Start/End: Complemental strand, 39018290 - 39018186
Alignment:
| Q |
188 |
tctattagatatacttcattaattgatgtggatttgctggtataattgtttttgccttttgtatatagttgtcttgtactataatacattaatgaagatg |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39018290 |
tctattagatatacttcattaattgatgtggatttgctggtataattgtttttgccttttgtatatagttgtcttgtactataatacattaatgaagatg |
39018191 |
T |
 |
| Q |
288 |
caagt |
292 |
Q |
| |
|
||||| |
|
|
| T |
39018190 |
caagt |
39018186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 73 - 160
Target Start/End: Complemental strand, 39018405 - 39018318
Alignment:
| Q |
73 |
atgagaatacaagaaaaatagaaagggatggaaaggtaagaggaagggatcattatgcattcagatgtgtaatgcatttatgaataag |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39018405 |
atgagaatacaagaaaaatagaaagggatggaaaggtaagaggaagggatcattatgcattcagatgtgtaatgcatttatgaataag |
39018318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University