View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_high_4 (Length: 570)
Name: NF0875_high_4
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0875_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 425; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 425; E-Value: 0
Query Start/End: Original strand, 30 - 558
Target Start/End: Original strand, 37039380 - 37039911
Alignment:
Q |
30 |
gtttgggccgcaatttgcggctgccacaaccactattgtttgacaccatatagcaggccaaaagcgttgtgctgaatccagcacggctatgctattccgc |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
37039380 |
gtttgggccgcaatttgcggctgccacaaccactattgtttgacaccatatcgcaggccaaaagcgttgtgctgaatccagcacggctacgctattccgc |
37039479 |
T |
 |
Q |
130 |
tatagcgtgctattgacagcatagatgttggnnnnnnnnnnnn---ccttctgttttgtgtatatgatgagttcaattgtttttgaagtttgaatgggaa |
226 |
Q |
|
|
||||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37039480 |
tatagcgtgatattgacagcatggatgttggttggtttttttttttccttctgttttgtgtatatgatgagttcaattgtttttgaagtttgaatgggaa |
37039579 |
T |
 |
Q |
227 |
tgatgatttcaggtacggagaggtgctgaccgagccgagatatatagccttgccttctcttccactgcacagtggttagctgtctcaagtgacaagggaa |
326 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
37039580 |
tgatgatttcaggtacggagaggtgctgaccgagccgagatatatagccttgccttctcttccagtgcacagtggttagctgtctcaagtgacaagggaa |
37039679 |
T |
 |
Q |
327 |
ccgttcatgtcttcaacttgaaggttgattcgggattgttggggcacgacagatcgcatactacatccgaatctagtcctactagcccgtcggcggcttc |
426 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
37039680 |
ccgttcatgtcttcaacttgaaggttgattcgggattgctggggcacgacagatcgcatactacatccgagtctagtcctactagcccgtcggcggcttc |
37039779 |
T |
 |
Q |
427 |
gtctctttcatttattagaggtttgtgcatttgtccactgttagttattcattcattagttatcatgtatggagattatgnnnnnnnaagtaactgttga |
526 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
37039780 |
gtctctttcatttattagaggtttgtgcatttgtccactgttagttattcattcattagttatcatgtatggagattatgtttttttaagtaactgttga |
37039879 |
T |
 |
Q |
527 |
acaaccataacgacatttgttgttgcaacagc |
558 |
Q |
|
|
|||||||||||| |||||||||||||| |||| |
|
|
T |
37039880 |
acaaccataacgccatttgttgttgcatcagc |
37039911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 263 - 339
Target Start/End: Original strand, 44207357 - 44207433
Alignment:
Q |
263 |
gagatatatagccttgccttctcttccactgcacagtggttagctgtctcaagtgacaagggaaccgttcatgtctt |
339 |
Q |
|
|
||||||||||| | || || || ||||| || ||||||||||| || |||||||||||||| || ||||||||||| |
|
|
T |
44207357 |
gagatatatagtttggcgttttcctccacagctcagtggttagcagtttcaagtgacaagggcactgttcatgtctt |
44207433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 941 times since January 2019
Visitors: 6134