View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_high_42 (Length: 283)
Name: NF0875_high_42
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 30 - 263
Target Start/End: Complemental strand, 29098482 - 29098248
Alignment:
| Q |
30 |
ggaaggagatttcatctttgtttgatgagaaatggtttattgatattgatattgataaagcaatgcagcgagttttgaagaggcatatctctactggcaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29098482 |
ggaaggagatttcatctttgtttgatgagaaatggtttattgatattgatattgataaagcaatgcagcgagttttgaagaggcatatctctactggcaa |
29098383 |
T |
 |
| Q |
130 |
gcctccagacattgctaagcagcgaatagagaacaacgacagactcaatgcagagcttataatgaagtcc-aagaaaaatgctgatataataatcaagtc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29098382 |
gcctccagacattgctaagcagcgaatagagaacaacgacagactcaatgcagaacttataatgaagtccaaagaaaaatgctgatataataatcaagtc |
29098283 |
T |
 |
| Q |
229 |
ggttgatttatgaggaagtaagtattataacttta |
263 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29098282 |
ggttgatttctgaggaagtaagtattataacttta |
29098248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 30 - 245
Target Start/End: Original strand, 27021104 - 27021319
Alignment:
| Q |
30 |
ggaaggagatttcatctttgtttgatgagaaatggtttattgatattgatattgataaagcaatgcagcgagttttgaagaggcatatctctactggcaa |
129 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27021104 |
ggaaggaaattttatctttgtttgatgagaaatggtttattgatattgatattgataaagcaatgcagcgagttttgaagaggcatatctctattggcaa |
27021203 |
T |
 |
| Q |
130 |
gcctccagacattgctaagcagcgaatagagaacaacgacagactcaatgcagagcttataatgaagtccaagaaaaatgctgatataataatcaagtcg |
229 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27021204 |
gcctccagacattgctaagcagcggatagagaacaacgacagaatcaatggagaacttataatgaagtccaagaaaaatgctgatataataatcaattcg |
27021303 |
T |
 |
| Q |
230 |
gttgatttatgaggaa |
245 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
27021304 |
gttgatttctgaggaa |
27021319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 155 - 245
Target Start/End: Complemental strand, 38534947 - 38534857
Alignment:
| Q |
155 |
atagagaacaacgacagactcaatgcagagcttataatgaagtccaagaaaaatgctgatataataatcaagtcggttgatttatgaggaa |
245 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38534947 |
atagagaacaacgacagactcaatgcagaacttataatgaagtccaagaaaaatgctgatataataatcaagtcggttgatttctgaggaa |
38534857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 126
Target Start/End: Complemental strand, 38535262 - 38535199
Alignment:
| Q |
63 |
ggtttattgatattgatattgataaagcaatgcagcgagttttgaagaggcatatctctactgg |
126 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38535262 |
ggtttattgatattgatatagataaagcaatgcagcgagttttgaagaggcatatctctactgg |
38535199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 65
Target Start/End: Complemental strand, 38536244 - 38536209
Alignment:
| Q |
30 |
ggaaggagatttcatctttgtttgatgagaaatggt |
65 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38536244 |
ggaaggaggtttcatctttgtttgatgagaaatggt |
38536209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 125 - 153
Target Start/End: Complemental strand, 38535092 - 38535064
Alignment:
| Q |
125 |
ggcaagcctccagacattgctaagcagcg |
153 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38535092 |
ggcaagcctccagacattgctaagcagcg |
38535064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University