View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0875_high_63 (Length: 227)

Name: NF0875_high_63
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0875_high_63
NF0875_high_63
[»] chr1 (3 HSPs)
chr1 (1-135)||(38822660-38822797)
chr1 (8-118)||(38831149-38831259)
chr1 (22-126)||(38814142-38814246)


Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 38822660 - 38822797
Alignment:
1 ctctctatgccagattatacctttgtaggcgttggtatcaaagataaattggttaagttagagaagcagtgtgggattggatac---ataaatgcatttg 97  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||    
38822660 ctctctatgccagattatacctttgtaggcgttggtatcaaagataaattggttaagttagagaagcagtgtgggattggatacataataaatgcatttg 38822759  T
98 aacttggaccacttgctgctactgttatggatatgcct 135  Q
    ||||||||||||||||||||||||||||||||||||||    
38822760 aacttggaccacttgctgctactgttatggatatgcct 38822797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 118
Target Start/End: Original strand, 38831149 - 38831259
Alignment:
8 tgccagattatacctttgtaggcgttggtatcaaagataaattggttaagttagagaagcagtgtgggattggatacataaatgcatttgaacttggacc 107  Q
    |||||||||||||||||||  | |||||||| |||||| | |||| |||| |  ||||| | | ||||||| ||| || ||||||  | |||||||||||    
38831149 tgccagattatacctttgtcagtgttggtattaaagatgatttggctaagcttaagaaggaatatgggattagatgcagaaatgctgtggaacttggacc 38831248  T
108 acttgctgcta 118  Q
     ||||||||||    
38831249 tcttgctgcta 38831259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 126
Target Start/End: Original strand, 38814142 - 38814246
Alignment:
22 tttgtaggcgttggtatcaaagataaattggttaagttagagaagcagtgtgggattggatacataaatgcatttgaacttggaccacttgctgctactg 121  Q
    ||||| || ||||| |||||||| || |||| |||||| |||||||||| |||  ||||||  | ||||||  |||||||||||||  ||||||| | ||    
38814142 tttgttggagttggaatcaaagagaatttggctaagttggagaagcagtatggatttggatgtagaaatgctgttgaacttggaccctttgctgcaagtg 38814241  T
122 ttatg 126  Q
    |||||    
38814242 ttatg 38814246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University