View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_10 (Length: 532)
Name: NF0875_low_10
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 3e-71; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 3e-71
Query Start/End: Original strand, 128 - 316
Target Start/End: Complemental strand, 2194506 - 2194318
Alignment:
| Q |
128 |
gtaattgttatgggacattttattcttttatttttatgaatttggatcctctcaattggtaaaataatttgagagatgaccccactattagaatatgcga |
227 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2194506 |
gtaattgttatgagacatttcatttttttatttttatgaatttggatcttctcaattgataaaataatttgagagatgaccccactattagaatatgcgg |
2194407 |
T |
 |
| Q |
228 |
atgatcaaacccacttgagttggcttgatggtaatgacttgagacttgggaatgtgctcctccggtgccaatttggatgagctaattta |
316 |
Q |
| |
|
||||||||||||||||||||||| |||| | ||||||||||||||| |||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
2194406 |
atgatcaaacccacttgagttggtctgatagcaatgacttgagacttaggaatgtgctcctccgatgccaatttagatgagctaattta |
2194318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 2194596 - 2194544
Alignment:
| Q |
30 |
gttggctgtcttgttcttgagtaagacaaaaaagttatgtcgataacatgaaa |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2194596 |
gttggctgtcttgttcttgagtaagacaaaaaagttatgtcgataacatgaaa |
2194544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 238 - 283
Target Start/End: Original strand, 28673948 - 28673993
Alignment:
| Q |
238 |
ccacttgagttggcttgatggtaatgacttgagacttgggaatgtg |
283 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||| | ||||||||| |
|
|
| T |
28673948 |
ccacttgggttggcttgatggtattgacttgagattggggaatgtg |
28673993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000003; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 233 - 290
Target Start/End: Complemental strand, 29197454 - 29197397
Alignment:
| Q |
233 |
caaacccacttgagttggcttgatggtaatgacttgagacttgggaatgtgctcctcc |
290 |
Q |
| |
|
|||||||||||| ||||||||| ||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
29197454 |
caaacccacttgggttggcttggtggtattgacttgggacttgggagtgtgctcctcc |
29197397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 235 - 290
Target Start/End: Original strand, 19016031 - 19016086
Alignment:
| Q |
235 |
aacccacttgagttggcttgatggtaatgacttgagacttgggaatgtgctcctcc |
290 |
Q |
| |
|
|||||||||| ||||| |||||||| || |||||||||||||| ||||||||||| |
|
|
| T |
19016031 |
aacccacttgggttggtctgatggtattggcttgagacttgggagtgtgctcctcc |
19016086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 236 - 288
Target Start/End: Complemental strand, 37756046 - 37755994
Alignment:
| Q |
236 |
acccacttgagttggcttgatggtaatgacttgagacttgggaatgtgctcct |
288 |
Q |
| |
|
||||||||| ||||||||| ||||| || |||| ||| ||||||||||||||| |
|
|
| T |
37756046 |
acccacttgggttggcttggtggtattggcttgggacctgggaatgtgctcct |
37755994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 234 - 290
Target Start/End: Original strand, 39714991 - 39715047
Alignment:
| Q |
234 |
aaacccacttgagttggcttgatggtaatgacttgagacttgggaatgtgctcctcc |
290 |
Q |
| |
|
||||||||||| |||||| || ||||| ||||||| ||| ||||| ||||||||||| |
|
|
| T |
39714991 |
aaacccacttgggttggcatggtggtattgacttgggacctgggagtgtgctcctcc |
39715047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 234 - 290
Target Start/End: Original strand, 28783059 - 28783115
Alignment:
| Q |
234 |
aaacccacttgagttggcttgatggtaatgacttgagacttgggaatgtgctcctcc |
290 |
Q |
| |
|
||||||||||| ||||||||| ||||| || |||||||| ||||| ||||||||||| |
|
|
| T |
28783059 |
aaacccacttgggttggcttggtggtattggcttgagacctgggagtgtgctcctcc |
28783115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 238 - 286
Target Start/End: Complemental strand, 3350528 - 3350480
Alignment:
| Q |
238 |
ccacttgagttggcttgatggtaatgacttgagacttgggaatgtgctc |
286 |
Q |
| |
|
||||||||||||| |||||||| |||||||||| |||||||||||||| |
|
|
| T |
3350528 |
ccacttgagttggtctgatggtattgacttgagatttgggaatgtgctc |
3350480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 235 - 290
Target Start/End: Complemental strand, 23301678 - 23301623
Alignment:
| Q |
235 |
aacccacttgagttggcttgatggtaatgacttgagacttgggaatgtgctcctcc |
290 |
Q |
| |
|
|||||||||| |||||| || ||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
23301678 |
aacccacttgggttggcctggtggtattgacttgggacttgggagtgtgctcctcc |
23301623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 234 - 290
Target Start/End: Original strand, 2446307 - 2446363
Alignment:
| Q |
234 |
aaacccacttgagttggcttgatggtaatgacttgagacttgggaatgtgctcctcc |
290 |
Q |
| |
|
||||||||||| ||||| |||||||| || |||| ||||||||| ||||||||||| |
|
|
| T |
2446307 |
aaacccacttgggttggtctgatggtattggcttgggacttgggagtgtgctcctcc |
2446363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 234 - 290
Target Start/End: Complemental strand, 30109385 - 30109329
Alignment:
| Q |
234 |
aaacccacttgagttggcttgatggtaatgacttgagacttgggaatgtgctcctcc |
290 |
Q |
| |
|
||||||||||| ||||||||| ||||| || |||| ||| ||||| ||||||||||| |
|
|
| T |
30109385 |
aaacccacttgggttggcttggtggtattggcttgtgacctgggagtgtgctcctcc |
30109329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000007; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 234 - 290
Target Start/End: Original strand, 40257398 - 40257454
Alignment:
| Q |
234 |
aaacccacttgagttggcttgatggtaatgacttgagacttgggaatgtgctcctcc |
290 |
Q |
| |
|
||||||||||| |||||| || ||||| || |||||||| ||||| ||||||||||| |
|
|
| T |
40257398 |
aaacccacttgggttggcctggtggtattggcttgagacctgggagtgtgctcctcc |
40257454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 234 - 290
Target Start/End: Original strand, 51814493 - 51814549
Alignment:
| Q |
234 |
aaacccacttgagttggcttgatggtaatgacttgagacttgggaatgtgctcctcc |
290 |
Q |
| |
|
||||||||||| |||||| |||||||| |||||||||| || || ||||||||||| |
|
|
| T |
51814493 |
aaacccacttgggttggcctgatggtattgacttgagatctgagagtgtgctcctcc |
51814549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University