View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_30 (Length: 414)
Name: NF0875_low_30
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 163 - 402
Target Start/End: Original strand, 8085987 - 8086224
Alignment:
| Q |
163 |
gtagtgtaatgcaagaagaaaacaatcacttatctgaacaccttcgtcatccatcactttgatcaccattgacaacaattccaaccaccactgatta-ta |
261 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8085987 |
gtagtgtaatgcaagaa---aacaatcacttatctgaacaccttcgtcatccatcactttgatcaccattgacaacaattccaaccaccactgattacta |
8086083 |
T |
|
| Q |
262 |
ttatgaccaaaactctagccgcctctcacccccacttaatttgatctccattggctaccactcagttggctaccatcaaccaccactgatcgccactcta |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8086084 |
ttatgaccaaaactctagccgcctctcacccccacttaatttgatctccattggctaccactcagttggctaccaccaaccaccactgatcgccactcta |
8086183 |
T |
|
| Q |
362 |
acaatcgccggtgattaacaatttagcaaaaccatgagtat |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8086184 |
gcaatcgccggtgattaacaatttagcaaaaccatgagtat |
8086224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 30 - 109
Target Start/End: Original strand, 8085854 - 8085933
Alignment:
| Q |
30 |
attgaatatattaaaataaaaagtagtgtaatgcaagaaaacccaaagaaacaaccatgtgtccaacaacgattatctca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8085854 |
attgaatatattaaaataaaaagtagtgtaatgcaagaaaacccaaagaaacaaccatgtgtacaacaacgattatctca |
8085933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3064 times since January 2019
Visitors: 6169