View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_36 (Length: 384)
Name: NF0875_low_36
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 88 - 378
Target Start/End: Complemental strand, 44488276 - 44487975
Alignment:
| Q |
88 |
cagggtaccatgtgattaatgctacagatgcttcaaattttacggttgataattttctgcaggggaatgtttggttgcctcaaatgggagttccttatat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44488276 |
cagggtaccatgtgattaatgctacagatgcttcaaattttacggttgacaattttctgcaggggaatgtttggttgcctcaaatgggagttccttatat |
44488177 |
T |
|
| Q |
188 |
tcgtgaacttacaacttttaattagagaacacaagaggaacgatgaataaaggactacata-----------ttgatgctgattgaagaccaaaattatt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44488176 |
tcgtgaacttacaacttttaattagagaacacaagaggaacgatgaataaaggactacatattgaggattaattgatgctgattgaagaccaaaattatt |
44488077 |
T |
|
| Q |
277 |
tgatatatttattctttgctgttgtttttaatatacttcaaaagtttttcaaaaggaagagctgcaggttttatttggtgggtgttctgcttcctatgct |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44488076 |
tgatatatttattctttgctgttgtttttaatatacttcaaaagtttttcaaaaggaagagctgcaggttttatttggtgggtgttctgcttcctttgct |
44487977 |
T |
|
| Q |
377 |
ac |
378 |
Q |
| |
|
|| |
|
|
| T |
44487976 |
ac |
44487975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2621 times since January 2019
Visitors: 6164