View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_41 (Length: 343)
Name: NF0875_low_41
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 4e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 94 - 335
Target Start/End: Complemental strand, 979097 - 978853
Alignment:
| Q |
94 |
agattaatcccctcttcttgatttctgaggtttttcctttgcttttgtttgggtccccctggtgctagaatcttttatctcctgggttgttatatgtgtt |
193 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
979097 |
agattaatcttctcttcttgatttttgaggtttttcctttgcttctgtttgggtccacctggtgctagaatcttttatctcctgggttcttatatgtgtc |
978998 |
T |
|
| Q |
194 |
tctttctttcagttgtactctacaagaattattgatttctttatcagagcgtattcaccttttctttttctatgtgcttttgtctgttaccctacataaa |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
978997 |
tctttctttcagttgtactctacaagaattattgatttctttatcataatgtattcaccttttctttttctctgtgcttttgtctgttaccctacagaaa |
978898 |
T |
|
| Q |
294 |
c---cttggtttcttctagatttcatctttctctatattcatctc |
335 |
Q |
| |
|
| |||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
978897 |
ccttcttggtttcttctagatttcatttttctctatattcttctc |
978853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 889 times since January 2019
Visitors: 6134