View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0875_low_41 (Length: 343)

Name: NF0875_low_41
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0875_low_41
NF0875_low_41
[»] chr7 (1 HSPs)
chr7 (94-335)||(978853-979097)


Alignment Details
Target: chr7 (Bit Score: 175; Significance: 4e-94; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 94 - 335
Target Start/End: Complemental strand, 979097 - 978853
Alignment:
94 agattaatcccctcttcttgatttctgaggtttttcctttgcttttgtttgggtccccctggtgctagaatcttttatctcctgggttgttatatgtgtt 193  Q
    |||||||||  ||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||     
979097 agattaatcttctcttcttgatttttgaggtttttcctttgcttctgtttgggtccacctggtgctagaatcttttatctcctgggttcttatatgtgtc 978998  T
194 tctttctttcagttgtactctacaagaattattgatttctttatcagagcgtattcaccttttctttttctatgtgcttttgtctgttaccctacataaa 293  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |  ||||||||||||||||||||| |||||||||||||||||||||||| |||    
978997 tctttctttcagttgtactctacaagaattattgatttctttatcataatgtattcaccttttctttttctctgtgcttttgtctgttaccctacagaaa 978898  T
294 c---cttggtttcttctagatttcatctttctctatattcatctc 335  Q
    |   |||||||||||||||||||||| ||||||||||||| ||||    
978897 ccttcttggtttcttctagatttcatttttctctatattcttctc 978853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 889 times since January 2019
Visitors: 6134